Perl Basics 1

Suggested Reading

Chapters 1, 2 & 4 of Learning Perl.

Lecture Notes

1. What is Perl?
2. Some simple Perl scripts
3. Mechanics of creating a Perl script
4. Statements
5. Literals
6. Operators
7. Functions
8. Variables
9. Processing the Command Line
10. Basic I/O

Problems

1. Create a script called "add" script to sum two arguments:

         % add 2 3
         5
         

2. Modify this script so that it checks that both arguments are present:

         % add 2
         Please provide two numeric arguments.
         

3. Create a script called "now" to print the current time of day:

         % now
         It is now Sun Jun 6 16:35:40 1999
         

4. Create a script to produce the reverse complement of a sequence (hint, use the reverse and tr/// functions:

         % reversec GAGAGAGAGAGTTTTTTTTT
         AAAAAAAAACTCTCTCTCTC