Exporting Variables and Functions from Modules

To make your module export variables and/or functions like a "real" module, use the Exporter module. 

package MySequence;
#file: MySequence.pm

use strict;
use base 'Exporter';

our @EXPORT    = qw(reversec seqlen);
our @EXPORT_OK = qw($EcoRI);

our $EcoRI = 'ggatcc';

sub reversec {
  my $sequence = shift;
  $sequence = reverse $sequence;
  $sequence =~ tr/gatcGATC/ctagCTAG/;
  return $sequence;
}

sub seqlen {
  my $sequence = shift;
  $sequence =~ s/[^gatcnGATCN]//g;
  return length $sequence;
}

1;

The use base 'Exporter' line tells Perl that this module is a type of "Exporter" module. As we will see later, this is a way for modules to inherit properties from other modules. The Exporter module (standard in Perl) knows how to export variables and functions.

The our @EXPORT = qw(reversec seqlen) line tells Perl to export the functions reversec and seqlen automatically. The our @EXPORT_OK = qw($EcoRI) tells Perl that it is OK for the user to import the $EcoRI variable, but not to export it automatically.

The qw() notation is telling Perl to create a list separated by spaces. These lines are equivalent to the slightly uglier: 

our @EXPORT    = ('reversec','seqlen');

Using the Better MySequence.pm Module

Now the module exports its reversec and seqlen functions automatically: 
  #!/usr/bin/perl
  #file: sequence2.pl

  use strict;
  use MySequence;

  my $sequence = 'gattccggatttccaaagggttcccaatttggg';
  my $complement = reversec($sequence);

  print "original   = $sequence\n";
  print "complement = $complement\n";

The calling program can also get at the value of the $EcoRI variable, but he has to ask for it explicitly: 
  #!/usr/bin/perl
  #file: sequence3.pl

  use strict;
  use MySequence qw(:DEFAULT $EcoRI);

  my $sequence = 'gattccggatttccaaagggttcccaatttggg';
  my $complement = reversec($sequence);

  print "original   = $sequence\n";
  print "complement = $complement\n";

  if ($complement =~ /$EcoRI/) {
    print "Contains an EcoRI site.\n";
  } else {
    print "Doesn't contain an EcoRI site.\n";
  }

Note that we must now import the :DEFAULT group in order to get the default reversec and seqlen functions.

<< Previous
 Contents >> Next >>
Lincoln D. Stein, lstein@cshl.org
Cold Spring Harbor Laboratory
Last modified: Tue Sep 21 10:53:38 EDT 1999